Eurexpress
A Transcriptome Atlas Database for Mouse Embryo
Old webpage   Quick Search:    for   
Quick Help:    Sitemap      Using Context Help  
Home > Databases > Template Information  

Eurexpress Template

Eurexpress Template ID: T35053
Clone ID E35053
Template ID T35053
Template Origin cDNA
Clone Image  
Validity OK
Gene symbol Wdr75
Gene description WD repeat domain 75
Gene Aliases 1300003A18Rik, 2410118I19Rik, C77608, FLJ12545, MGC143988
MGI ID MGI:1920924
Entrez Gene ID 73674
Ref Seq Accession NM_028599
Chromosome Location 1
ENSEMBL Transcript ID  
ENSEMBL Gene ID  
ENSEMBL version  
Vector (Plasmid)  
AntiSense Promoter Sp6
Sense Promoter  
Forward Primer 075577_F_cDNA_2410118I19Rik
Forward Primer Sequences CCCAAACTGAACTAACAAAGGC
Reverse Primer 075577_N_SP6_cDNA_2410118I19Rik
Reverse Primer Sequences GCGATTTAGGTGACACTATAGGTCGGGTTCCATAACTCTAACA
Template Plate 10001_TEM
Template Well 10001_TEM_A03
Template Group  
Template Sequence Status  
Template Sequence ID  
TGU M
 Template Sequence