Eurexpress
A Transcriptome Atlas Database for Mouse Embryo
Old webpage   Quick Search:    for   
Quick Help:    Sitemap      Using Context Help  
Home > Databases > Template Information  

Eurexpress Template

Eurexpress Template ID: T3490
Clone ID E3490
Template ID T3490
Template Origin Plasmid
Clone Image 333866
Validity OK
Gene symbol Fbxo32
Gene description F-box only protein 32 (Fbxo32)
Gene Aliases MAFbx, AI430017, ATROGIN1, atrogin-1, 4833442G10Rik
MGI ID MGI:1914981
Entrez Gene ID 67731
Ref Seq Accession NM_026346
Chromosome Location 15
ENSEMBL Transcript ID ENSMUST00000022986
ENSEMBL Gene ID ENSMUSG00000022358
ENSEMBL version  
Vector (Plasmid) pT7T3D-PacI
AntiSense Promoter T3
Sense Promoter T7
Forward Primer RZPD M13 forward
Forward Primer Sequences GCTATTACGCCAGCTGGCGAAAGGGGGATGTG
Reverse Primer RZPD M13 reverse
Reverse Primer Sequences CCCCAGGCTTTACACTTTATGCTTCCGGCTCG
Template Plate 38
Template Well E02
Template Group  
Template Sequence Status Partial
Template Sequence ID 333866_r1AI391271BX5
TGU B
 Template Sequence