Eurexpress
A Transcriptome Atlas Database for Mouse Embryo
Old webpage   Quick Search:    for   
Quick Help:    Sitemap      Using Context Help  
Home > Databases > Template Information  

Eurexpress Template

Eurexpress Template ID: T3488
Clone ID E3488
Template ID T3488
Template Origin Plasmid
Clone Image 333721
Validity OK
Gene symbol Wdr45l
Gene description Wdr45 like (Wdr45l)
Gene Aliases D16Bwg0193e, 0610008N23Rik
MGI ID MGI:1914090
Entrez Gene ID 66840
Ref Seq Accession NM_025793
Chromosome Location 11
ENSEMBL Transcript ID ENSMUST00000026173
ENSEMBL Gene ID ENSMUSG00000025173
ENSEMBL version  
Vector (Plasmid) pT7T3D-PacI
AntiSense Promoter T3
Sense Promoter T7
Forward Primer RZPD M13 forward
Forward Primer Sequences GCTATTACGCCAGCTGGCGAAAGGGGGATGTG
Reverse Primer RZPD M13 reverse
Reverse Primer Sequences CCCCAGGCTTTACACTTTATGCTTCCGGCTCG
Template Plate 38
Template Well D12
Template Group  
Template Sequence Status Partial
Template Sequence ID 333721_r1AI391260BX5
TGU B
 Template Sequence