Eurexpress
A Transcriptome Atlas Database for Mouse Embryo
Old webpage   Quick Search:    for   
Quick Help:    Sitemap      Using Context Help  
Home > Databases > Template Information  

Eurexpress Template

Eurexpress Template ID: T3487
Clone ID E3487
Template ID T3487
Template Origin Plasmid
Clone Image 333628
Validity OK
Gene symbol BC038286
Gene description cDNA sequence BC038286 (BC038286)
Gene Aliases MGC47289
MGI ID MGI:2388278
Entrez Gene ID 227298
Ref Seq Accession NM_170755
Chromosome Location 1
ENSEMBL Transcript ID ENSMUST00000060113
ENSEMBL Gene ID ENSMUSG00000049339
ENSEMBL version  
Vector (Plasmid) pT7T3D-PacI
AntiSense Promoter T3
Sense Promoter T7
Forward Primer RZPD M13 forward
Forward Primer Sequences GCTATTACGCCAGCTGGCGAAAGGGGGATGTG
Reverse Primer RZPD M13 reverse
Reverse Primer Sequences CCCCAGGCTTTACACTTTATGCTTCCGGCTCG
Template Plate 38
Template Well D11
Template Group  
Template Sequence Status Partial
Template Sequence ID 333628_r1AI391254BX5
TGU B
 Template Sequence