Eurexpress
A Transcriptome Atlas Database for Mouse Embryo
Old webpage   Quick Search:    for   
Quick Help:    Sitemap      Using Context Help  
Home > Databases > Template Information  

Eurexpress Template

Eurexpress Template ID: T3486
Clone ID E3486
Template ID T3486
Template Origin Plasmid
Clone Image 333606
Validity OK
Gene symbol Usp10
Gene description ubiquitin specific protease 10 (Usp10)
Gene Aliases UBPO, Uchrp, mKIAA0190, 2610014N07Rik
MGI ID MGI:894652
Entrez Gene ID 22224
Ref Seq Accession NM_009462
Chromosome Location 8
ENSEMBL Transcript ID ENSMUST00000034283
ENSEMBL Gene ID ENSMUSG00000031826
ENSEMBL version  
Vector (Plasmid) pT7T3D-PacI
AntiSense Promoter T3
Sense Promoter T7
Forward Primer RZPD M13 forward
Forward Primer Sequences GCTATTACGCCAGCTGGCGAAAGGGGGATGTG
Reverse Primer RZPD M13 reverse
Reverse Primer Sequences CCCCAGGCTTTACACTTTATGCTTCCGGCTCG
Template Plate 38
Template Well D10
Template Group  
Template Sequence Status Partial
Template Sequence ID 333606_r1AI391251W15
TGU B
 Template Sequence