Eurexpress
A Transcriptome Atlas Database for Mouse Embryo
Old webpage   Quick Search:    for   
Quick Help:    Sitemap      Using Context Help  
Home > Databases > Template Information  

Eurexpress Template

Eurexpress Template ID: T3463
Clone ID E3463
Template ID T3463
Template Origin Plasmid
Clone Image 330191
Validity OK
Gene symbol Rps3a
Gene description ribosomal protein S3a (Rps3a)
Gene Aliases MGC
MGI ID MGI:1202063
Entrez Gene ID 20091
Ref Seq Accession NM_016959
Chromosome Location 3
ENSEMBL Transcript ID ENSMUST00000029722
ENSEMBL Gene ID ENSMUSG00000028081
ENSEMBL version  
Vector (Plasmid) pT7T3D-PacI
AntiSense Promoter T3
Sense Promoter T7
Forward Primer RZPD M13 forward
Forward Primer Sequences GCTATTACGCCAGCTGGCGAAAGGGGGATGTG
Reverse Primer RZPD M13 reverse
Reverse Primer Sequences CCCCAGGCTTTACACTTTATGCTTCCGGCTCG
Template Plate 38
Template Well B11
Template Group  
Template Sequence Status Partial
Template Sequence ID 330191_r1W13272AI608
TGU B
 Template Sequence