Eurexpress
A Transcriptome Atlas Database for Mouse Embryo
Old webpage   Quick Search:    for   
Quick Help:    Sitemap      Using Context Help  
Home > Databases > Template Information  

Eurexpress Template

Eurexpress Template ID: T3460
Clone ID E3460
Template ID T3460
Template Origin Plasmid
Clone Image 329994
Validity OK
Gene symbol Sct
Gene description secretin (Sct)
Gene Aliases  
MGI ID MGI:99466
Entrez Gene ID 20287
Ref Seq Accession NM_011328
Chromosome Location 7
ENSEMBL Transcript ID ENSMUST00000046156
ENSEMBL Gene ID ENSMUSG00000038580
ENSEMBL version  
Vector (Plasmid) pT7T3D-PacI
AntiSense Promoter T3
Sense Promoter T7
Forward Primer RZPD M13 forward
Forward Primer Sequences GCTATTACGCCAGCTGGCGAAAGGGGGATGTG
Reverse Primer RZPD M13 reverse
Reverse Primer Sequences CCCCAGGCTTTACACTTTATGCTTCCGGCTCG
Template Plate 38
Template Well B08
Template Group  
Template Sequence Status Partial
Template Sequence ID 329994_r1AI327501BX5
TGU B
 Template Sequence