Eurexpress
A Transcriptome Atlas Database for Mouse Embryo
Old webpage   Quick Search:    for   
Quick Help:    Sitemap      Using Context Help  
Home > Databases > Template Information  

Eurexpress Template

Eurexpress Template ID: T3459
Clone ID E3459
Template ID T3459
Template Origin Plasmid
Clone Image 329993
Validity OK
Gene symbol Scarb2
Gene description scavenger receptor class B, member 2 (Scarb2)
Gene Aliases LGP85, Cd36l2, LIMP-2, MLGP85, 9330185J12Rik
MGI ID MGI:1196458
Entrez Gene ID 12492
Ref Seq Accession NM_007644
Chromosome Location 5
ENSEMBL Transcript ID ENSMUST00000031377
ENSEMBL Gene ID ENSMUSG00000029426
ENSEMBL version  
Vector (Plasmid) pT7T3D-PacI
AntiSense Promoter T3
Sense Promoter T7
Forward Primer RZPD M13 forward
Forward Primer Sequences GCTATTACGCCAGCTGGCGAAAGGGGGATGTG
Reverse Primer RZPD M13 reverse
Reverse Primer Sequences CCCCAGGCTTTACACTTTATGCTTCCGGCTCG
Template Plate 38
Template Well B07
Template Group  
Template Sequence Status Partial
Template Sequence ID 329993_r1AI451771BX5
TGU B
 Template Sequence