Eurexpress
A Transcriptome Atlas Database for Mouse Embryo
Old webpage   Quick Search:    for   
Quick Help:    Sitemap      Using Context Help  
Home > Databases > Template Information  

Eurexpress Template

Eurexpress Template ID: T3458
Clone ID E3458
Template ID T3458
Template Origin Plasmid
Clone Image 329940
Validity OK
Gene symbol Car6
Gene description carbonic anhydrase 6 (Car6)
Gene Aliases DOC1
MGI ID MGI:1333786
Entrez Gene ID 12353
Ref Seq Accession NM_009802
Chromosome Location 4
ENSEMBL Transcript ID ENSMUST00000030817
ENSEMBL Gene ID ENSMUSG00000028972
ENSEMBL version  
Vector (Plasmid) pT7T3D-PacI
AntiSense Promoter T3
Sense Promoter T7
Forward Primer RZPD M13 forward
Forward Primer Sequences GCTATTACGCCAGCTGGCGAAAGGGGGATGTG
Reverse Primer RZPD M13 reverse
Reverse Primer Sequences CCCCAGGCTTTACACTTTATGCTTCCGGCTCG
Template Plate 38
Template Well B06
Template Group  
Template Sequence Status Partial
Template Sequence ID 329940_r1AI327498BX5
TGU B
 Template Sequence