Eurexpress
A Transcriptome Atlas Database for Mouse Embryo
Old webpage   Quick Search:    for   
Quick Help:    Sitemap      Using Context Help  
Home > Databases > Template Information  

Eurexpress Template

Eurexpress Template ID: T345
Clone ID E345
Template ID T345
Template Origin Plasmid
Clone Image 3154888
Validity OK
Gene symbol Daxx
Gene description Fas death domain-associated protein (Daxx)
Gene Aliases  
MGI ID MGI:1197015
Entrez Gene ID 13163
Ref Seq Accession NM_007829
Chromosome Location 17
ENSEMBL Transcript ID NA
ENSEMBL Gene ID NA
ENSEMBL version  
Vector (Plasmid) pCMV-SPORT6
AntiSense Promoter T7
Sense Promoter Sp6
Forward Primer RZPD T7
Forward Primer Sequences TAATACGACTCACTATAGGG
Reverse Primer RZPD sp6
Reverse Primer Sequences ATTTAGGTGACACTATAG
Template Plate 4
Template Well F12
Template Group  
Template Sequence Status Partial
Template Sequence ID 3154888_r1AW763571BX
TGU M
 Template Sequence