Eurexpress
A Transcriptome Atlas Database for Mouse Embryo
Old webpage   Quick Search:    for   
Quick Help:    Sitemap      Using Context Help  
Home > Databases > Template Information  

Eurexpress Template

Eurexpress Template ID: T3436
Clone ID E3436
Template ID T3436
Template Origin Plasmid
Clone Image 3025949
Validity OK
Gene symbol Inpp1
Gene description inositol polyphosphate-1-phosphatase (Inpp1)
Gene Aliases  
MGI ID MGI:104848
Entrez Gene ID 16329
Ref Seq Accession NM_008384
Chromosome Location 1
ENSEMBL Transcript ID ENSMUST00000027271
ENSEMBL Gene ID ENSMUSG00000026102
ENSEMBL version  
Vector (Plasmid) pT7T3D-PacI
AntiSense Promoter T3
Sense Promoter T7
Forward Primer RZPD M13 forward
Forward Primer Sequences GCTATTACGCCAGCTGGCGAAAGGGGGATGTG
Reverse Primer RZPD M13 reverse
Reverse Primer Sequences CCCCAGGCTTTACACTTTATGCTTCCGGCTCG
Template Plate 37
Template Well H08
Template Group  
Template Sequence Status Partial
Template Sequence ID 3025949_r1AW744380BX
TGU B
 Template Sequence