Eurexpress
A Transcriptome Atlas Database for Mouse Embryo
Old webpage   Quick Search:    for   
Quick Help:    Sitemap      Using Context Help  
Home > Databases > Template Information  

Eurexpress Template

Eurexpress Template ID: T3411
Clone ID E3411
Template ID T3411
Template Origin Plasmid
Clone Image 3025705
Validity OK
Gene symbol Atp6v0e
Gene description ATPase, H+ transporting, V0 subunit (Atp6v0e)
Gene Aliases M9.2, Atp6k
MGI ID MGI:1328318
Entrez Gene ID 11974
Ref Seq Accession NM_025272
Chromosome Location 17
ENSEMBL Transcript ID ENSMUST00000015719
ENSEMBL Gene ID ENSMUSG00000015575
ENSEMBL version  
Vector (Plasmid) pT7T3D-PacI
AntiSense Promoter T3
Sense Promoter T7
Forward Primer RZPD M13 forward
Forward Primer Sequences GCTATTACGCCAGCTGGCGAAAGGGGGATGTG
Reverse Primer RZPD M13 reverse
Reverse Primer Sequences CCCCAGGCTTTACACTTTATGCTTCCGGCTCG
Template Plate 37
Template Well F07
Template Group  
Template Sequence Status Partial
Template Sequence ID 3025705_r1BX521450AW
TGU B
 Template Sequence