Eurexpress
A Transcriptome Atlas Database for Mouse Embryo
Old webpage   Quick Search:    for   
Quick Help:    Sitemap      Using Context Help  
Home > Databases > Template Information  

Eurexpress Template

Eurexpress Template ID: T3406
Clone ID E3406
Template ID T3406
Template Origin Plasmid
Clone Image 3025588
Validity OK
Gene symbol Armcx1
Gene description armadillo repeat containing, X-linked 1 (Armcx1)
Gene Aliases ALEX1, 3010033I09Rik
MGI ID MGI:1925498
Entrez Gene ID 78248
Ref Seq Accession NM_030066
Chromosome Location X
ENSEMBL Transcript ID ENSMUST00000051256
ENSEMBL Gene ID ENSMUSG00000033460
ENSEMBL version  
Vector (Plasmid) pT7T3D-PacI
AntiSense Promoter T3
Sense Promoter T7
Forward Primer RZPD M13 forward
Forward Primer Sequences GCTATTACGCCAGCTGGCGAAAGGGGGATGTG
Reverse Primer RZPD M13 reverse
Reverse Primer Sequences CCCCAGGCTTTACACTTTATGCTTCCGGCTCG
Template Plate 37
Template Well F02
Template Group  
Template Sequence Status Partial
Template Sequence ID 3025588_r1AW744156BX
TGU B
 Template Sequence