Eurexpress
A Transcriptome Atlas Database for Mouse Embryo
Old webpage   Quick Search:    for   
Quick Help:    Sitemap      Using Context Help  
Home > Databases > Template Information  

Eurexpress Template

Eurexpress Template ID: T3394
Clone ID E3394
Template ID T3394
Template Origin Plasmid
Clone Image 2939243
Validity OK
Gene symbol Ngef
Gene description neuronal guanine nucleotide exchange factor (Ngef)
Gene Aliases Tims2, ephexin
MGI ID MGI:1858414
Entrez Gene ID 53972
Ref Seq Accession NM_019867
Chromosome Location 1
ENSEMBL Transcript ID ENSMUST00000027477
ENSEMBL Gene ID ENSMUSG00000026259
ENSEMBL version  
Vector (Plasmid) pT7T3D-PacI
AntiSense Promoter T3
Sense Promoter T7
Forward Primer RZPD M13 forward
Forward Primer Sequences GCTATTACGCCAGCTGGCGAAAGGGGGATGTG
Reverse Primer RZPD M13 reverse
Reverse Primer Sequences CCCCAGGCTTTACACTTTATGCTTCCGGCTCG
Template Plate 37
Template Well E02
Template Group  
Template Sequence Status Partial
Template Sequence ID 2939243_r1AW742112BX
TGU B
 Template Sequence