Eurexpress
A Transcriptome Atlas Database for Mouse Embryo
Old webpage   Quick Search:    for   
Quick Help:    Sitemap      Using Context Help  
Home > Databases > Template Information  

Eurexpress Template

Eurexpress Template ID: T3390
Clone ID E3390
Template ID T3390
Template Origin Plasmid
Clone Image 2939167
Validity OK
Gene symbol Ppp1r14b
Gene description protein phosphatase 1, regulatory (inhibitor) subunit 14B (Ppp1r14b)
Gene Aliases Png, PHI-1, AOM172, PLCB3N
MGI ID MGI:107682
Entrez Gene ID 18938
Ref Seq Accession NM_008889
Chromosome Location 19
ENSEMBL Transcript ID ENSMUST00000070850
ENSEMBL Gene ID ENSMUSG00000056612
ENSEMBL version  
Vector (Plasmid) pT7T3D-PacI
AntiSense Promoter T3
Sense Promoter T7
Forward Primer RZPD M13 forward
Forward Primer Sequences GCTATTACGCCAGCTGGCGAAAGGGGGATGTG
Reverse Primer RZPD M13 reverse
Reverse Primer Sequences CCCCAGGCTTTACACTTTATGCTTCCGGCTCG
Template Plate 37
Template Well D10
Template Group  
Template Sequence Status Partial
Template Sequence ID 2939167_r1AW742064BX
TGU B
 Template Sequence