Eurexpress
A Transcriptome Atlas Database for Mouse Embryo
Old webpage   Quick Search:    for   
Quick Help:    Sitemap      Using Context Help  
Home > Databases > Template Information  

Eurexpress Template

Eurexpress Template ID: T3372
Clone ID E3372
Template ID T3372
Template Origin Plasmid
Clone Image 2937332
Validity OK
Gene symbol 1810049H13Rik
Gene description RIKEN cDNA 1810049H13 gene (1810049H13Rik)
Gene Aliases  
MGI ID MGI:1913681
Entrez Gene ID 66431
Ref Seq Accession NM_025560
Chromosome Location 11
ENSEMBL Transcript ID ENSMUST00000044007
ENSEMBL Gene ID ENSMUSG00000039670
ENSEMBL version  
Vector (Plasmid) pT7T3D-PacI
AntiSense Promoter T3
Sense Promoter T7
Forward Primer RZPD M13 forward
Forward Primer Sequences GCTATTACGCCAGCTGGCGAAAGGGGGATGTG
Reverse Primer RZPD M13 reverse
Reverse Primer Sequences CCCCAGGCTTTACACTTTATGCTTCCGGCTCG
Template Plate 37
Template Well C04
Template Group  
Template Sequence Status Partial
Template Sequence ID 2937332_r1BX523530AW
TGU B
 Template Sequence