Eurexpress
A Transcriptome Atlas Database for Mouse Embryo
Old webpage   Quick Search:    for   
Quick Help:    Sitemap      Using Context Help  
Home > Databases > Template Information  

Eurexpress Template

Eurexpress Template ID: T3371
Clone ID E3371
Template ID T3371
Template Origin Plasmid
Clone Image 2937272
Validity OK
Gene symbol Scarf2
Gene description scavenger receptor class F, member 2 (Scarf2)
Gene Aliases NSR1, Srec2, Scarf1, Scatf1, SrecII, SREC-II, SRECRP-1
MGI ID MGI:1858430
Entrez Gene ID 224024
Ref Seq Accession NM_153790
Chromosome Location 16
ENSEMBL Transcript ID ENSMUST00000012161
ENSEMBL Gene ID ENSMUSG00000012017
ENSEMBL version  
Vector (Plasmid) pT7T3D-PacI
AntiSense Promoter T3
Sense Promoter T7
Forward Primer RZPD M13 forward
Forward Primer Sequences GCTATTACGCCAGCTGGCGAAAGGGGGATGTG
Reverse Primer RZPD M13 reverse
Reverse Primer Sequences CCCCAGGCTTTACACTTTATGCTTCCGGCTCG
Template Plate 37
Template Well C03
Template Group  
Template Sequence Status Partial
Template Sequence ID 2937272_r1AW476627BX
TGU B
 Template Sequence