Eurexpress
A Transcriptome Atlas Database for Mouse Embryo
Old webpage   Quick Search:    for   
Quick Help:    Sitemap      Using Context Help  
Home > Databases > Template Information  

Eurexpress Template

Eurexpress Template ID: T3369
Clone ID E3369
Template ID T3369
Template Origin Plasmid
Clone Image 2937253
Validity OK
Gene symbol Ppargc1b
Gene description peroxisome proliferative activated receptor, gamma, coactivator 1 beta (Ppargc1b)
Gene Aliases Perc, 4631412G21Rik
MGI ID MGI:2444934
Entrez Gene ID 170826
Ref Seq Accession NM_133249
Chromosome Location 18
ENSEMBL Transcript ID ENSMUST00000075299
ENSEMBL Gene ID ENSMUSG00000033871
ENSEMBL version  
Vector (Plasmid) pT7T3D-PacI
AntiSense Promoter T3
Sense Promoter T7
Forward Primer RZPD M13 forward
Forward Primer Sequences GCTATTACGCCAGCTGGCGAAAGGGGGATGTG
Reverse Primer RZPD M13 reverse
Reverse Primer Sequences CCCCAGGCTTTACACTTTATGCTTCCGGCTCG
Template Plate 37
Template Well C01
Template Group  
Template Sequence Status Partial
Template Sequence ID 2937253_r1AW476619BX
TGU B
 Template Sequence