Eurexpress
A Transcriptome Atlas Database for Mouse Embryo
Old webpage   Quick Search:    for   
Quick Help:    Sitemap      Using Context Help  
Home > Databases > Template Information  

Eurexpress Template

Eurexpress Template ID: T3366
Clone ID E3366
Template ID T3366
Template Origin Plasmid
Clone Image 2936849
Validity OK
Gene symbol 3010026O09Rik
Gene description RIKEN cDNA 3010026O09 gene (3010026O09Rik)
Gene Aliases 2900016G09Rik
MGI ID MGI:1915317
Entrez Gene ID 68067
Ref Seq Accession NM_026543
Chromosome Location 11
ENSEMBL Transcript ID ENSMUST00000020647
ENSEMBL Gene ID ENSMUSG00000020381
ENSEMBL version  
Vector (Plasmid) pT7T3D-PacI
AntiSense Promoter T3
Sense Promoter T7
Forward Primer RZPD M13 forward
Forward Primer Sequences GCTATTACGCCAGCTGGCGAAAGGGGGATGTG
Reverse Primer RZPD M13 reverse
Reverse Primer Sequences CCCCAGGCTTTACACTTTATGCTTCCGGCTCG
Template Plate 37
Template Well B10
Template Group  
Template Sequence Status Partial
Template Sequence ID 2936849_r1BX524367AW
TGU B
 Template Sequence