Eurexpress
A Transcriptome Atlas Database for Mouse Embryo
Old webpage   Quick Search:    for   
Quick Help:    Sitemap      Using Context Help  
Home > Databases > Template Information  

Eurexpress Template

Eurexpress Template ID: T3345
Clone ID E3345
Template ID T3345
Template Origin Plasmid
Clone Image 317328
Validity OK
Gene symbol 1700001C02Rik
Gene description RIKEN cDNA 1700001C02 gene (1700001C02Rik)
Gene Aliases 1700047H18Rik
MGI ID MGI:1922684
Entrez Gene ID 75434
Ref Seq Accession NM_029285
Chromosome Location 5
ENSEMBL Transcript ID ENSMUST00000031078
ENSEMBL Gene ID ENSMUSG00000029182
ENSEMBL version  
Vector (Plasmid) pT7T3D-PacI
AntiSense Promoter T3
Sense Promoter T7
Forward Primer RZPD M13 forward
Forward Primer Sequences GCTATTACGCCAGCTGGCGAAAGGGGGATGTG
Reverse Primer RZPD M13 reverse
Reverse Primer Sequences CCCCAGGCTTTACACTTTATGCTTCCGGCTCG
Template Plate 37
Template Well A01
Template Group  
Template Sequence Status Partial
Template Sequence ID 317328_r1AI536301BX5
TGU B
 Template Sequence