Eurexpress
A Transcriptome Atlas Database for Mouse Embryo
Old webpage   Quick Search:    for   
Quick Help:    Sitemap      Using Context Help  
Home > Databases > Template Information  

Eurexpress Template

Eurexpress Template ID: T3321
Clone ID E3321
Template ID T3321
Template Origin Plasmid
Clone Image 2781101
Validity OK
Gene symbol Vdac1
Gene description voltage-dependent anion channel 1 (Vdac1)
Gene Aliases Vdac5
MGI ID MGI:106919
Entrez Gene ID 22333
Ref Seq Accession NM_011694
Chromosome Location 11
ENSEMBL Transcript ID ENSMUST00000020673
ENSEMBL Gene ID ENSMUSG00000020402
ENSEMBL version  
Vector (Plasmid) pT7T3D-PacI
AntiSense Promoter T3
Sense Promoter T7
Forward Primer RZPD M13 forward
Forward Primer Sequences GCTATTACGCCAGCTGGCGAAAGGGGGATGTG
Reverse Primer RZPD M13 reverse
Reverse Primer Sequences CCCCAGGCTTTACACTTTATGCTTCCGGCTCG
Template Plate 36
Template Well G01
Template Group  
Template Sequence Status Partial
Template Sequence ID 2781101_r1AW743403BX
TGU B
 Template Sequence