Eurexpress
A Transcriptome Atlas Database for Mouse Embryo
Old webpage   Quick Search:    for   
Quick Help:    Sitemap      Using Context Help  
Home > Databases > Template Information  

Eurexpress Template

Eurexpress Template ID: T3293
Clone ID E3293
Template ID T3293
Template Origin Plasmid
Clone Image 2780435
Validity OK
Gene symbol Arl3
Gene description ADP-ribosylation factor-like 3 (Arl3)
Gene Aliases  
MGI ID MGI:1929699
Entrez Gene ID 56350
Ref Seq Accession NM_019718
Chromosome Location 19
ENSEMBL Transcript ID ENSMUST00000026009
ENSEMBL Gene ID ENSMUSG00000025035
ENSEMBL version  
Vector (Plasmid) pT7T3D-PacI
AntiSense Promoter T3
Sense Promoter T7
Forward Primer RZPD M13 forward
Forward Primer Sequences GCTATTACGCCAGCTGGCGAAAGGGGGATGTG
Reverse Primer RZPD M13 reverse
Reverse Primer Sequences CCCCAGGCTTTACACTTTATGCTTCCGGCTCG
Template Plate 36
Template Well D09
Template Group  
Template Sequence Status Partial
Template Sequence ID 2780435_r1AW742612BX
TGU B
 Template Sequence