Eurexpress
A Transcriptome Atlas Database for Mouse Embryo
Old webpage   Quick Search:    for   
Quick Help:    Sitemap      Using Context Help  
Home > Databases > Template Information  

Eurexpress Template

Eurexpress Template ID: T328
Clone ID E328
Template ID T328
Template Origin Plasmid
Clone Image 3154456
Validity OK
Gene symbol Srxn1
Gene description sulfiredoxin 1 homolog (S. cerevisiae) (Srxn1)
Gene Aliases Srx, Npn3, TX01, 1700127B04Rik
MGI ID MGI:104971
Entrez Gene ID 76650
Ref Seq Accession NM_029688
Chromosome Location 2
ENSEMBL Transcript ID ENSMUST00000041500
ENSEMBL Gene ID ENSMUSG00000032802
ENSEMBL version  
Vector (Plasmid) pCMV-SPORT6
AntiSense Promoter T7
Sense Promoter Sp6
Forward Primer RZPD T7
Forward Primer Sequences TAATACGACTCACTATAGGG
Reverse Primer RZPD sp6
Reverse Primer Sequences ATTTAGGTGACACTATAG
Template Plate 4
Template Well E07
Template Group  
Template Sequence Status Partial
Template Sequence ID BC0113253154456_r1AW
TGU M
 Template Sequence