Eurexpress II Home Page
Image
 
Image
  Home > Database > Keyword Search
Image
Image Image  
  • Search by
  Keyword
  Sequence
  Anatomy
  • Partners
  EMAGE
  GenePaint
 
 
 
Image Image
 
 
 
  View Template Information

EURExpress Template ID: T3221
Clone ID E3221
Template ID T3221
Template Generating Unit B
Plate 35
Well F09
Clone image 2699035
Gene symbol Mad2l1
Gene description MAD2 (mitotic arrest deficient, homolog)-like 1 (yeast) (Mad2l1)
Aliases MGC, MAD2
Entrez gene ID 56150
Entrez ID version  
mRNA reference sequence NM_019499
Entrez accession ID version  
ENSEMB transcript ID ENSMUST00000079549
Transcript version 29
ENSEMB gene ID ENSMUSG00000029910
Gene version 29
Template status OK
Working reference  
Sequence Status  
Plasmid name pT7T3D-PacI
Promoter to generate antisense probe T3
Antisense promoter primer sequence AATTAACCCTCACTAAAGGGAGA
Forward and reverse primers position  
Forward and reverse primer sequences  
Sequence
 

Web page contact:
Copyright © 1994-2006. All Rights Reserved.