Eurexpress
A Transcriptome Atlas Database for Mouse Embryo
Old webpage   Quick Search:    for   
Quick Help:    Sitemap      Using Context Help  
Home > Databases > Template Information  

Eurexpress Template

Eurexpress Template ID: T3218
Clone ID E3218
Template ID T3218
Template Origin Plasmid
Clone Image 2698798
Validity OK
Gene symbol Vbp1
Gene description von Hippel-Lindau binding protein 1 (Vbp1)
Gene Aliases  
MGI ID MGI:1333804
Entrez Gene ID 22327
Ref Seq Accession NM_011692
Chromosome Location X
ENSEMBL Transcript ID NA
ENSEMBL Gene ID NA
ENSEMBL version  
Vector (Plasmid) pT7T3D-PacI
AntiSense Promoter T3
Sense Promoter T7
Forward Primer RZPD M13 forward
Forward Primer Sequences GCTATTACGCCAGCTGGCGAAAGGGGGATGTG
Reverse Primer RZPD M13 reverse
Reverse Primer Sequences CCCCAGGCTTTACACTTTATGCTTCCGGCTCG
Template Plate 35
Template Well F06
Template Group  
Template Sequence Status Partial
Template Sequence ID 2698798_r1AW519505BX
TGU B
 Template Sequence