Eurexpress
A Transcriptome Atlas Database for Mouse Embryo
Old webpage   Quick Search:    for   
Quick Help:    Sitemap      Using Context Help  
Home > Databases > Template Information  

Eurexpress Template

Eurexpress Template ID: T3216
Clone ID E3216
Template ID T3216
Template Origin Plasmid
Clone Image 2698776
Validity OK
Gene symbol Arl6ip5
Gene description ADP-ribosylation factor-like 6 interacting protein 5 (Arl6ip5)
Gene Aliases Aip-5, Gtrap3-18, 5930404D22Rik
MGI ID MGI:1929501
Entrez Gene ID 65106
Ref Seq Accession NM_022992
Chromosome Location 6
ENSEMBL Transcript ID ENSMUST00000044681
ENSEMBL Gene ID ENSMUSG00000035199
ENSEMBL version  
Vector (Plasmid) pT7T3D-PacI
AntiSense Promoter T3
Sense Promoter T7
Forward Primer RZPD M13 forward
Forward Primer Sequences GCTATTACGCCAGCTGGCGAAAGGGGGATGTG
Reverse Primer RZPD M13 reverse
Reverse Primer Sequences CCCCAGGCTTTACACTTTATGCTTCCGGCTCG
Template Plate 35
Template Well F04
Template Group  
Template Sequence Status Partial
Template Sequence ID 2698776_r1AW519501BX
TGU B
 Template Sequence