Eurexpress
A Transcriptome Atlas Database for Mouse Embryo
Old webpage   Quick Search:    for   
Quick Help:    Sitemap      Using Context Help  
Home > Databases > Template Information  

Eurexpress Template

Eurexpress Template ID: T319
Clone ID E319
Template ID T319
Template Origin Plasmid
Clone Image 3153975
Validity OK
Gene symbol BC003498
Gene description cDNA sequence BC00398 (BC003498)
Gene Aliases MGC6957
MGI ID MGI:1918215
Entrez Gene ID 80295
Ref Seq Accession NM_030263
Chromosome Location 8
ENSEMBL Transcript ID NA
ENSEMBL Gene ID NA
ENSEMBL version  
Vector (Plasmid) pCMV-SPORT6
AntiSense Promoter T7
Sense Promoter Sp6
Forward Primer RZPD T7
Forward Primer Sequences TAATACGACTCACTATAGGG
Reverse Primer RZPD sp6
Reverse Primer Sequences ATTTAGGTGACACTATAG
Template Plate 4
Template Well D10
Template Group  
Template Sequence Status Partial
Template Sequence ID BC0034983153975_r1AW
TGU B
 Template Sequence