Eurexpress
A Transcriptome Atlas Database for Mouse Embryo
Old webpage   Quick Search:    for   
Quick Help:    Sitemap      Using Context Help  
Home > Databases > Template Information  

Eurexpress Template

Eurexpress Template ID: T3148
Clone ID E3148
Template ID T3148
Template Origin Plasmid
Clone Image 1547874
Validity OK
Gene symbol Wig1
Gene description wild-type p53-induced gene 1 (Wig1)
Gene Aliases  
MGI ID MGI:1195270
Entrez Gene ID 22401
Ref Seq Accession NM_009517
Chromosome Location 3
ENSEMBL Transcript ID ENSMUST00000029199
ENSEMBL Gene ID ENSMUSG00000027663
ENSEMBL version  
Vector (Plasmid) pT7T3D-PacI
AntiSense Promoter T3
Sense Promoter T7
Forward Primer RZPD M13 forward
Forward Primer Sequences GCTATTACGCCAGCTGGCGAAAGGGGGATGTG
Reverse Primer RZPD M13 reverse
Reverse Primer Sequences CCCCAGGCTTTACACTTTATGCTTCCGGCTCG
Template Plate 34
Template Well H08
Template Group  
Template Sequence Status Partial
Template Sequence ID 1547874_r1BE196934BX
TGU B
 Template Sequence