Eurexpress
A Transcriptome Atlas Database for Mouse Embryo
Old webpage   Quick Search:    for   
Quick Help:    Sitemap      Using Context Help  
Home > Databases > Template Information  

Eurexpress Template

Eurexpress Template ID: T3077
Clone ID E3077
Template ID T3077
Template Origin Plasmid
Clone Image 1546819
Validity OK
Gene symbol 5730528L13Rik
Gene description RIKEN cDNA 5730528L13 gene (5730528L13Rik)
Gene Aliases 2410046L14Rik, 2810429P03Rik
MGI ID MGI:1913915
Entrez Gene ID 66665
Ref Seq Accession NM_028137
Chromosome Location 4
ENSEMBL Transcript ID ENSMUST00000061135
ENSEMBL Gene ID ENSMUSG00000039693
ENSEMBL version  
Vector (Plasmid) pT7T3D-PacI
AntiSense Promoter T3
Sense Promoter T7
Forward Primer RZPD M13 forward
Forward Primer Sequences GCTATTACGCCAGCTGGCGAAAGGGGGATGTG
Reverse Primer RZPD M13 reverse
Reverse Primer Sequences CCCCAGGCTTTACACTTTATGCTTCCGGCTCG
Template Plate 34
Template Well B09
Template Group  
Template Sequence Status Partial
Template Sequence ID 1546819_r1BE137212BX
TGU B
 Template Sequence