Eurexpress
A Transcriptome Atlas Database for Mouse Embryo
Old webpage   Quick Search:    for   
Quick Help:    Sitemap      Using Context Help  
Home > Databases > Template Information  

Eurexpress Template

Eurexpress Template ID: T3047
Clone ID E3047
Template ID T3047
Template Origin Plasmid
Clone Image 1546140
Validity OK
Gene symbol Ptgfrn
Gene description prostaglandin F2 receptor negative regulator (Ptgfrn)
Gene Aliases FPRP, CD9P-1, Trim45, 4833445A08Rik
MGI ID MGI:1277114
Entrez Gene ID 19221
Ref Seq Accession NM_011197
Chromosome Location 3
ENSEMBL Transcript ID ENSMUST00000029457
ENSEMBL Gene ID ENSMUSG00000027864
ENSEMBL version  
Vector (Plasmid) pT7T3D-PacI
AntiSense Promoter T3
Sense Promoter T7
Forward Primer RZPD M13 forward
Forward Primer Sequences GCTATTACGCCAGCTGGCGAAAGGGGGATGTG
Reverse Primer RZPD M13 reverse
Reverse Primer Sequences CCCCAGGCTTTACACTTTATGCTTCCGGCTCG
Template Plate 33
Template Well H03
Template Group  
Template Sequence Status Partial
Template Sequence ID 1546140_r1BE135652BX
TGU B
 Template Sequence