Eurexpress
A Transcriptome Atlas Database for Mouse Embryo
Old webpage   Quick Search:    for   
Quick Help:    Sitemap      Using Context Help  
Home > Databases > Template Information  

Eurexpress Template

Eurexpress Template ID: T2964
Clone ID E2964
Template ID T2964
Template Origin Plasmid
Clone Image 1532300
Validity OK
Gene symbol 1110005A03Rik
Gene description RIKEN cDNA 1110005A03 gene (1110005A03Rik)
Gene Aliases 4933424L15Rik
MGI ID MGI:1921569
Entrez Gene ID 74319
Ref Seq Accession NM_028865
Chromosome Location 11
ENSEMBL Transcript ID ENSMUST00000021171
ENSEMBL Gene ID ENSMUSG00000020815
ENSEMBL version  
Vector (Plasmid) pT7T3D-PacI
AntiSense Promoter T3
Sense Promoter T7
Forward Primer RZPD M13 forward
Forward Primer Sequences GCTATTACGCCAGCTGGCGAAAGGGGGATGTG
Reverse Primer RZPD M13 reverse
Reverse Primer Sequences CCCCAGGCTTTACACTTTATGCTTCCGGCTCG
Template Plate 33
Template Well A04
Template Group  
Template Sequence Status Partial
Template Sequence ID 1532300_r1BE135002BX
TGU B
 Template Sequence