Eurexpress
A Transcriptome Atlas Database for Mouse Embryo
Old webpage   Quick Search:    for   
Quick Help:    Sitemap      Using Context Help  
Home > Databases > Template Information  

Eurexpress Template

Eurexpress Template ID: T2933
Clone ID E2933
Template ID T2933
Template Origin Plasmid
Clone Image 1531717
Validity OK
Gene symbol B3gat3
Gene description beta-1,3-glucuronyltransferase 3 (glucuronosyltransferase I) (B3gat3)
Gene Aliases 2810405M13Rik
MGI ID MGI:1919977
Entrez Gene ID 72727
Ref Seq Accession NM_024256
Chromosome Location 19
ENSEMBL Transcript ID ENSMUST00000003779
ENSEMBL Gene ID ENSMUSG00000003682
ENSEMBL version  
Vector (Plasmid) pT7T3D-PacI
AntiSense Promoter T3
Sense Promoter T7
Forward Primer RZPD M13 forward
Forward Primer Sequences GCTATTACGCCAGCTGGCGAAAGGGGGATGTG
Reverse Primer RZPD M13 reverse
Reverse Primer Sequences CCCCAGGCTTTACACTTTATGCTTCCGGCTCG
Template Plate 32
Template Well F09
Template Group  
Template Sequence Status Partial
Template Sequence ID 1531717_r1BE134494BX
TGU M
 Template Sequence