Eurexpress
A Transcriptome Atlas Database for Mouse Embryo
Old webpage   Quick Search:    for   
Quick Help:    Sitemap      Using Context Help  
Home > Databases > Template Information  

Eurexpress Template

Eurexpress Template ID: T2931
Clone ID E2931
Template ID T2931
Template Origin Plasmid
Clone Image 1531696
Validity OK
Gene symbol 1110002B05Rik
Gene description RIKEN cDNA 1110002B05 gene (1110002B05Rik)
Gene Aliases  
MGI ID MGI:1913399
Entrez Gene ID 104725
Ref Seq Accession NM_134054
Chromosome Location 12
ENSEMBL Transcript ID ENSMUST00000056228
ENSEMBL Gene ID ENSMUSG00000044408
ENSEMBL version  
Vector (Plasmid) pT7T3D-PacI
AntiSense Promoter T3
Sense Promoter T7
Forward Primer RZPD M13 forward
Forward Primer Sequences GCTATTACGCCAGCTGGCGAAAGGGGGATGTG
Reverse Primer RZPD M13 reverse
Reverse Primer Sequences CCCCAGGCTTTACACTTTATGCTTCCGGCTCG
Template Plate 32
Template Well F07
Template Group  
Template Sequence Status Partial
Template Sequence ID 1531696_r1BE134465BX
TGU M
 Template Sequence