Eurexpress
A Transcriptome Atlas Database for Mouse Embryo
Old webpage   Quick Search:    for   
Quick Help:    Sitemap      Using Context Help  
Home > Databases > Template Information  

Eurexpress Template

Eurexpress Template ID: T2894
Clone ID E2894
Template ID T2894
Template Origin Plasmid
Clone Image 1530988
Validity OK
Gene symbol Erbb2ip
Gene description Erbb2 interacting protein (Erbb2ip), transcript variant 1
Gene Aliases Erbin, mKIAA1225, 1700028E05Rik
MGI ID MGI:1890169
Entrez Gene ID 59079
Ref Seq Accession NM_001005868
Chromosome Location 13
ENSEMBL Transcript ID ENSMUST00000022222
ENSEMBL Gene ID ENSMUSG00000021709
ENSEMBL version  
Vector (Plasmid) pT7T3D-PacI
AntiSense Promoter T3
Sense Promoter T7
Forward Primer RZPD M13 forward
Forward Primer Sequences GCTATTACGCCAGCTGGCGAAAGGGGGATGTG
Reverse Primer RZPD M13 reverse
Reverse Primer Sequences CCCCAGGCTTTACACTTTATGCTTCCGGCTCG
Template Plate 32
Template Well C06
Template Group  
Template Sequence Status Partial
Template Sequence ID 1530988_r1AW988391BX
TGU M
 Template Sequence