Eurexpress
A Transcriptome Atlas Database for Mouse Embryo
Old webpage   Quick Search:    for   
Quick Help:    Sitemap      Using Context Help  
Home > Databases > Template Information  

Eurexpress Template

Eurexpress Template ID: T2885
Clone ID E2885
Template ID T2885
Template Origin Plasmid
Clone Image 1530690
Validity OK
Gene symbol Vps28
Gene description vacuolar protein sorting 28 (yeast) (Vps28)
Gene Aliases 1110014J03Rik, D730005C08Rik
MGI ID MGI:1914164
Entrez Gene ID 66914
Ref Seq Accession NM_025842
Chromosome Location 15
ENSEMBL Transcript ID ENSMUST00000078803
ENSEMBL Gene ID ENSMUSG00000062381
ENSEMBL version  
Vector (Plasmid) pT7T3D-PacI
AntiSense Promoter T3
Sense Promoter T7
Forward Primer RZPD M13 forward
Forward Primer Sequences GCTATTACGCCAGCTGGCGAAAGGGGGATGTG
Reverse Primer RZPD M13 reverse
Reverse Primer Sequences CCCCAGGCTTTACACTTTATGCTTCCGGCTCG
Template Plate 32
Template Well B09
Template Group  
Template Sequence Status Partial
Template Sequence ID 1530690_r1AW988258BX
TGU M
 Template Sequence