Eurexpress
A Transcriptome Atlas Database for Mouse Embryo
Old webpage   Quick Search:    for   
Quick Help:    Sitemap      Using Context Help  
Home > Databases > Template Information  

Eurexpress Template

Eurexpress Template ID: T2842
Clone ID E2842
Template ID T2842
Template Origin Plasmid
Clone Image 1528951
Validity OK
Gene symbol Bad
Gene description Bcl-associated death promoter (Bad)
Gene Aliases Bbc2
MGI ID MGI:1096330
Entrez Gene ID 12015
Ref Seq Accession NM_007522
Chromosome Location 19
ENSEMBL Transcript ID ENSMUST00000025910
ENSEMBL Gene ID ENSMUSG00000024959
ENSEMBL version  
Vector (Plasmid) pT7T3D-PacI
AntiSense Promoter T3
Sense Promoter T7
Forward Primer RZPD M13 forward
Forward Primer Sequences GCTATTACGCCAGCTGGCGAAAGGGGGATGTG
Reverse Primer RZPD M13 reverse
Reverse Primer Sequences CCCCAGGCTTTACACTTTATGCTTCCGGCTCG
Template Plate 31
Template Well G02
Template Group  
Template Sequence Status Partial
Template Sequence ID 1528951_r1AW985785BX
TGU M
 Template Sequence