Eurexpress
A Transcriptome Atlas Database for Mouse Embryo
Old webpage   Quick Search:    for   
Quick Help:    Sitemap      Using Context Help  
Home > Databases > Template Information  

Eurexpress Template

Eurexpress Template ID: T2836
Clone ID E2836
Template ID T2836
Template Origin Plasmid
Clone Image 1528880
Validity OK
Gene symbol 1700047I17Rik
Gene description RIKEN cDNA 1700047I17 gene (1700047I17Rik)
Gene Aliases C14orf24, D730001C10Rik
MGI ID MGI:1920635
Entrez Gene ID 73385
Ref Seq Accession NM_028527
Chromosome Location 12
ENSEMBL Transcript ID ENSMUST00000038355
ENSEMBL Gene ID ENSMUSG00000034953
ENSEMBL version  
Vector (Plasmid) pT7T3D-PacI
AntiSense Promoter T3
Sense Promoter T7
Forward Primer RZPD M13 forward
Forward Primer Sequences GCTATTACGCCAGCTGGCGAAAGGGGGATGTG
Reverse Primer RZPD M13 reverse
Reverse Primer Sequences CCCCAGGCTTTACACTTTATGCTTCCGGCTCG
Template Plate 31
Template Well F08
Template Group  
Template Sequence Status Partial
Template Sequence ID 1528880_r1AW985711BX
TGU M
 Template Sequence