Eurexpress
A Transcriptome Atlas Database for Mouse Embryo
Old webpage   Quick Search:    for   
Quick Help:    Sitemap      Using Context Help  
Home > Databases > Template Information  

Eurexpress Template

Eurexpress Template ID: T2796
Clone ID E2796
Template ID T2796
Template Origin Plasmid
Clone Image 1515827
Validity OK
Gene symbol Ict1
Gene description immature colon carcinoma transcript 1 (Ict1)
Gene Aliases 1110001A02Rik, 1110002E03Rik
MGI ID MGI:1915822
Entrez Gene ID 68572
Ref Seq Accession NM_026729
Chromosome Location 11
ENSEMBL Transcript ID ENSMUST00000021079
ENSEMBL Gene ID ENSMUSG00000018858
ENSEMBL version  
Vector (Plasmid) pT7T3D-PacI
AntiSense Promoter T3
Sense Promoter T7
Forward Primer RZPD M13 forward
Forward Primer Sequences GCTATTACGCCAGCTGGCGAAAGGGGGATGTG
Reverse Primer RZPD M13 reverse
Reverse Primer Sequences CCCCAGGCTTTACACTTTATGCTTCCGGCTCG
Template Plate 31
Template Well C04
Template Group  
Template Sequence Status Partial
Template Sequence ID 1515827_r1AW823909BX
TGU M
 Template Sequence