Eurexpress
A Transcriptome Atlas Database for Mouse Embryo
Old webpage   Quick Search:    for   
Quick Help:    Sitemap      Using Context Help  
Home > Databases > Template Information  

Eurexpress Template

Eurexpress Template ID: T2768
Clone ID E2768
Template ID T2768
Template Origin Plasmid
Clone Image 1514787
Validity OK
Gene symbol 9430010O03Rik
Gene description RIKEN cDNA 9430010O03 gene (9430010O03Rik)
Gene Aliases C130008N12
MGI ID MGI:2442985
Entrez Gene ID 234023
Ref Seq Accession NM_176849
Chromosome Location 8
ENSEMBL Transcript ID ENSMUST00000048545
ENSEMBL Gene ID ENSMUSG00000040459
ENSEMBL version  
Vector (Plasmid) pT7T3D-PacI
AntiSense Promoter T3
Sense Promoter T7
Forward Primer RZPD M13 forward
Forward Primer Sequences GCTATTACGCCAGCTGGCGAAAGGGGGATGTG
Reverse Primer RZPD M13 reverse
Reverse Primer Sequences CCCCAGGCTTTACACTTTATGCTTCCGGCTCG
Template Plate 30
Template Well H12
Template Group  
Template Sequence Status Partial
Template Sequence ID 1514787_r1AW913206BX
TGU M
 Template Sequence