Eurexpress
A Transcriptome Atlas Database for Mouse Embryo
Old webpage   Quick Search:    for   
Quick Help:    Sitemap      Using Context Help  
Home > Databases > Template Information  

Eurexpress Template

Eurexpress Template ID: T2694
Clone ID E2694
Template ID T2694
Template Origin Plasmid
Clone Image 1512097
Validity OK
Gene symbol BC026744
Gene description cDNA sequence BC026744 (BC026744)
Gene Aliases FLJ12750, MGC25614, 2300007F24Rik
MGI ID MGI:1916724
Entrez Gene ID 330192
Ref Seq Accession NM_177876
Chromosome Location 5
ENSEMBL Transcript ID ENSMUST00000040967
ENSEMBL Gene ID ENSMUSG00000038184
ENSEMBL version  
Vector (Plasmid) pT7T3D-PacI
AntiSense Promoter T3
Sense Promoter T7
Forward Primer RZPD M13 forward
Forward Primer Sequences GCTATTACGCCAGCTGGCGAAAGGGGGATGTG
Reverse Primer RZPD M13 reverse
Reverse Primer Sequences CCCCAGGCTTTACACTTTATGCTTCCGGCTCG
Template Plate 30
Template Well B10
Template Group  
Template Sequence Status Partial
Template Sequence ID 1512097_r1AW988993BX
TGU M
 Template Sequence