Eurexpress
A Transcriptome Atlas Database for Mouse Embryo
Old webpage   Quick Search:    for   
Quick Help:    Sitemap      Using Context Help  
Home > Databases > Template Information  

Eurexpress Template

Eurexpress Template ID: T2597
Clone ID E2597
Template ID T2597
Template Origin Plasmid
Clone Image 1383752
Validity OK
Gene symbol Vars2l
Gene description valyl-tRNA synthetase 2-like (Vars2l)
Gene Aliases mKIAA1885, 1190004I24Rik
MGI ID MGI:1916165
Entrez Gene ID 68915
Ref Seq Accession NM_175137
Chromosome Location 17
ENSEMBL Transcript ID ENSMUST00000043674
ENSEMBL Gene ID ENSMUSG00000038838
ENSEMBL version  
Vector (Plasmid) pT7T3D-PacI
AntiSense Promoter T3
Sense Promoter T7
Forward Primer RZPD M13 forward
Forward Primer Sequences GCTATTACGCCAGCTGGCGAAAGGGGGATGTG
Reverse Primer RZPD M13 reverse
Reverse Primer Sequences CCCCAGGCTTTACACTTTATGCTTCCGGCTCG
Template Plate 29
Template Well B09
Template Group  
Template Sequence Status Partial
Template Sequence ID 1383752_r1AI180918BX
TGU M
 Template Sequence