Eurexpress
A Transcriptome Atlas Database for Mouse Embryo
Old webpage   Quick Search:    for   
Quick Help:    Sitemap      Using Context Help  
Home > Databases > Template Information  

Eurexpress Template

Eurexpress Template ID: T2575
Clone ID E2575
Template ID T2575
Template Origin Plasmid
Clone Image 1383129
Validity OK
Gene symbol Vps45
Gene description vacuolar protein sorting 45 (yeast) (Vps45)
Gene Aliases mVps45
MGI ID MGI:891965
Entrez Gene ID 22365
Ref Seq Accession NM_013841
Chromosome Location 3
ENSEMBL Transcript ID ENSMUST00000015891
ENSEMBL Gene ID ENSMUSG00000015747
ENSEMBL version  
Vector (Plasmid) pT7T3D-PacI
AntiSense Promoter T3
Sense Promoter T7
Forward Primer RZPD M13 forward
Forward Primer Sequences GCTATTACGCCAGCTGGCGAAAGGGGGATGTG
Reverse Primer RZPD M13 reverse
Reverse Primer Sequences CCCCAGGCTTTACACTTTATGCTTCCGGCTCG
Template Plate 28
Template Well H11
Template Group  
Template Sequence Status Partial
Template Sequence ID 1383129_r1AI120785BX
TGU M
 Template Sequence