Eurexpress
A Transcriptome Atlas Database for Mouse Embryo
Old webpage   Quick Search:    for   
Quick Help:    Sitemap      Using Context Help  
Home > Databases > Template Information  

Eurexpress Template

Eurexpress Template ID: T2545
Clone ID E2545
Template ID T2545
Template Origin Plasmid
Clone Image 1382148
Validity OK
Gene symbol Col5a2
Gene description procollagen, type V, alpha 2 (Col5a2)
Gene Aliases D230017N05
MGI ID MGI:88458
Entrez Gene ID 12832
Ref Seq Accession NM_007737
Chromosome Location 1
ENSEMBL Transcript ID NA
ENSEMBL Gene ID NA
ENSEMBL version  
Vector (Plasmid) pT7T3D-PacI
AntiSense Promoter T3
Sense Promoter T7
Forward Primer RZPD M13 forward
Forward Primer Sequences GCTATTACGCCAGCTGGCGAAAGGGGGATGTG
Reverse Primer RZPD M13 reverse
Reverse Primer Sequences CCCCAGGCTTTACACTTTATGCTTCCGGCTCG
Template Plate 28
Template Well F05
Template Group  
Template Sequence Status Partial
Template Sequence ID 1382148_r1AA798203BX
TGU M
 Template Sequence