Eurexpress
A Transcriptome Atlas Database for Mouse Embryo
Old webpage   Quick Search:    for   
Quick Help:    Sitemap      Using Context Help  
Home > Databases > Template Information  

Eurexpress Template

Eurexpress Template ID: T2520
Clone ID E2520
Template ID T2520
Template Origin Plasmid
Clone Image 1362387
Validity OK
Gene symbol Ercc8
Gene description excision repaiross-complementing rodent repair deficiency, complementation group 8 (Ercc8)
Gene Aliases Csa, Ckn1, 2410022P04Rik, 2810431L23Rik, 4631412O06Rik, B130065P18Rik
MGI ID MGI:1919241
Entrez Gene ID 71991
Ref Seq Accession NM_028042
Chromosome Location 13
ENSEMBL Transcript ID ENSMUST00000054835
ENSEMBL Gene ID ENSMUSG00000021694
ENSEMBL version  
Vector (Plasmid) pT7T3D-PacI
AntiSense Promoter T3
Sense Promoter T7
Forward Primer RZPD M13 forward
Forward Primer Sequences GCTATTACGCCAGCTGGCGAAAGGGGGATGTG
Reverse Primer RZPD M13 reverse
Reverse Primer Sequences CCCCAGGCTTTACACTTTATGCTTCCGGCTCG
Template Plate 28
Template Well D04
Template Group  
Template Sequence Status Partial
Template Sequence ID 1362387_r1BX511450AA
TGU M
 Template Sequence