Eurexpress
A Transcriptome Atlas Database for Mouse Embryo
Old webpage   Quick Search:    for   
Quick Help:    Sitemap      Using Context Help  
Home > Databases > Template Information  

Eurexpress Template

Eurexpress Template ID: T2519
Clone ID E2519
Template ID T2519
Template Origin Plasmid
Clone Image 1361810
Validity OK
Gene symbol 4931417A20
Gene description hypothetical protein 4931417A20 (4931417A20)
Gene Aliases 4931417A20, BC095976
MGI ID MGI:3606488
Entrez Gene ID 211936
Ref Seq Accession NM_177600
Chromosome Location 2
ENSEMBL Transcript ID ENSMUST00000055635
ENSEMBL Gene ID ENSMUSG00000045106
ENSEMBL version  
Vector (Plasmid) pT7T3D-PacI
AntiSense Promoter T3
Sense Promoter T7
Forward Primer RZPD M13 forward
Forward Primer Sequences GCTATTACGCCAGCTGGCGAAAGGGGGATGTG
Reverse Primer RZPD M13 reverse
Reverse Primer Sequences CCCCAGGCTTTACACTTTATGCTTCCGGCTCG
Template Plate 28
Template Well D03
Template Group  
Template Sequence Status Partial
Template Sequence ID 1361810_r1BX511999AA
TGU M
 Template Sequence