Eurexpress
A Transcriptome Atlas Database for Mouse Embryo
Old webpage   Quick Search:    for   
Quick Help:    Sitemap      Using Context Help  
Home > Databases > Template Information  

Eurexpress Template

Eurexpress Template ID: T2502
Clone ID E2502
Template ID T2502
Template Origin Plasmid
Clone Image 1265049
Validity OK
Gene symbol Pigw
Gene description phosphatidylinositol glycan, class W (Pigw)
Gene Aliases Gwt1, 2610044A17Rik
MGI ID MGI:1917575
Entrez Gene ID 70325
Ref Seq Accession NM_027388
Chromosome Location 11
ENSEMBL Transcript ID ENSMUST00000067058
ENSEMBL Gene ID ENSMUSG00000045140
ENSEMBL version  
Vector (Plasmid) pT7T3D-PacI
AntiSense Promoter T3
Sense Promoter T7
Forward Primer RZPD M13 forward
Forward Primer Sequences GCTATTACGCCAGCTGGCGAAAGGGGGATGTG
Reverse Primer RZPD M13 reverse
Reverse Primer Sequences CCCCAGGCTTTACACTTTATGCTTCCGGCTCG
Template Plate 28
Template Well B10
Template Group  
Template Sequence Status Partial
Template Sequence ID 1265049_r1AA881622AI
TGU M
 Template Sequence