Eurexpress
A Transcriptome Atlas Database for Mouse Embryo
Old webpage   Quick Search:    for   
Quick Help:    Sitemap      Using Context Help  
Home > Databases > Template Information  

Eurexpress Template

Eurexpress Template ID: T2454
Clone ID E2454
Template ID T2454
Template Origin Plasmid
Clone Image 1247757
Validity OK
Gene symbol Gzmb
Gene description granzyme B (Gzmb)
Gene Aliases CCP1, Ctla1, Ctla-1, CCP-1/C11
MGI ID MGI:109267
Entrez Gene ID 14939
Ref Seq Accession NM_013542
Chromosome Location 14
ENSEMBL Transcript ID ENSMUST00000015581
ENSEMBL Gene ID ENSMUSG00000015437
ENSEMBL version  
Vector (Plasmid) pT7T3D-PacI
AntiSense Promoter T3
Sense Promoter T7
Forward Primer RZPD M13 forward
Forward Primer Sequences GCTATTACGCCAGCTGGCGAAAGGGGGATGTG
Reverse Primer RZPD M13 reverse
Reverse Primer Sequences CCCCAGGCTTTACACTTTATGCTTCCGGCTCG
Template Plate 27
Template Well F10
Template Group  
Template Sequence Status Partial
Template Sequence ID 1247757_r1AA759614BX
TGU M
 Template Sequence