Eurexpress
A Transcriptome Atlas Database for Mouse Embryo
Old webpage   Quick Search:    for   
Quick Help:    Sitemap      Using Context Help  
Home > Databases > Template Information  

Eurexpress Template

Eurexpress Template ID: T2453
Clone ID E2453
Template ID T2453
Template Origin Plasmid
Clone Image 1247704
Validity OK
Gene symbol AW538196
Gene description expressed sequence AW538196 (AW538196)
Gene Aliases  
MGI ID MGI:2142246
Entrez Gene ID 101869
Ref Seq Accession NM_133952
Chromosome Location 7
ENSEMBL Transcript ID ENSMUST00000032748
ENSEMBL Gene ID ENSMUSG00000030533
ENSEMBL version  
Vector (Plasmid) pT7T3D-PacI
AntiSense Promoter T3
Sense Promoter T7
Forward Primer RZPD M13 forward
Forward Primer Sequences GCTATTACGCCAGCTGGCGAAAGGGGGATGTG
Reverse Primer RZPD M13 reverse
Reverse Primer Sequences CCCCAGGCTTTACACTTTATGCTTCCGGCTCG
Template Plate 27
Template Well F09
Template Group  
Template Sequence Status Partial
Template Sequence ID 1247704_r1AA759560BX
TGU M
 Template Sequence