Eurexpress
A Transcriptome Atlas Database for Mouse Embryo
Old webpage   Quick Search:    for   
Quick Help:    Sitemap      Using Context Help  
Home > Databases > Template Information  

Eurexpress Template

Eurexpress Template ID: T2452
Clone ID E2452
Template ID T2452
Template Origin Plasmid
Clone Image 1247588
Validity OK
Gene symbol Adipoq
Gene description adiponectin, C1Q and collagen domain containing (Adipoq)
Gene Aliases Acdc, apM1, 30kDa, GBP28, adipo, Acrp30
MGI ID MGI:106675
Entrez Gene ID 11450
Ref Seq Accession NM_009605
Chromosome Location 16
ENSEMBL Transcript ID ENSMUST00000023593
ENSEMBL Gene ID ENSMUSG00000022878
ENSEMBL version  
Vector (Plasmid) pT7T3D-PacI
AntiSense Promoter T3
Sense Promoter T7
Forward Primer RZPD M13 forward
Forward Primer Sequences GCTATTACGCCAGCTGGCGAAAGGGGGATGTG
Reverse Primer RZPD M13 reverse
Reverse Primer Sequences CCCCAGGCTTTACACTTTATGCTTCCGGCTCG
Template Plate 27
Template Well F08
Template Group  
Template Sequence Status Partial
Template Sequence ID 1247588_r1AA763396BX
TGU M
 Template Sequence