Eurexpress
A Transcriptome Atlas Database for Mouse Embryo
Old webpage   Quick Search:    for   
Quick Help:    Sitemap      Using Context Help  
Home > Databases > Template Information  

Eurexpress Template

Eurexpress Template ID: T2451
Clone ID E2451
Template ID T2451
Template Origin Plasmid
Clone Image 1247566
Validity OK
Gene symbol Mcoln1
Gene description mucolipin 1 (Mcoln1)
Gene Aliases MGC7172
MGI ID MGI:1890498
Entrez Gene ID 94178
Ref Seq Accession NM_053177
Chromosome Location 8
ENSEMBL Transcript ID NA
ENSEMBL Gene ID NA
ENSEMBL version  
Vector (Plasmid) pT7T3D-PacI
AntiSense Promoter T3
Sense Promoter T7
Forward Primer RZPD M13 forward
Forward Primer Sequences GCTATTACGCCAGCTGGCGAAAGGGGGATGTG
Reverse Primer RZPD M13 reverse
Reverse Primer Sequences CCCCAGGCTTTACACTTTATGCTTCCGGCTCG
Template Plate 27
Template Well F07
Template Group  
Template Sequence Status Partial
Template Sequence ID 1247566_r1AA763375BX
TGU M
 Template Sequence